nordhauschrist nordhauschrist

01-12-2017
History

contestada

What was the purpose of the Berlin Wall and how was the US involved in its end?

Respuesta :

ravenalanaclark ravenalanaclark

01-12-2017

the eastern sector of Berlin controlled by the Soviet Union, and the western sectors occupied by theUnited States, France, and Great Britain.

Answer Link

Otras preguntas

PLEASE HELP ME!! What was the name of the system developed by FDR Roosevelt during the Great Depression to aid lower income people? B) Medicare C) M

distillation definition chemistry

An important change in the american family in the nineteenth century was

Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.

2x + 3y = 144x + 6y = 28 Which statement about the pair of equations is true?

The most famous trade route, the silk road, connected _____________ with _________ and ___________.

Some puritans wanted to separate from the Church of England

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How is the creation of public policy in Russia different from that in the United States?

what is the absolute value of the complex number -4 — √2i