Gemgirl8899 Gemgirl8899

03-11-2015
Mathematics

contestada

Change the subject of the formulae to b::: 8a + 3b = 12. And 3b^2=27

Respuesta :

03-11-2015

8a + 3b = 12
3b = 12 - 8a

[tex]b = \frac{12-8a}{3}[/tex]

And...

3b^2 = 27
b^2 = 9
[tex]b = \pm 3[/tex]
b = 3
b = -3

Answer Link

Otras preguntas

Given that A=xy find the percentage increase in A when both X and Y increase by 10%

What are at least three differences between apes and humans in the cranium and teeth?

Asexual reproduction _____. see concept 13.1 (page 255) asexual reproduction _____. see concept 13.1 (page 255) leads to a loss of genetic material requires bo

what does a light year measure

This rectangular prism is created with centimeter cubes. how many cubed centimeters make up this prism? rectangular prism composed of unit cubes. cm3

Adrien needs to use an effective sanitizer to finish cleaning a piece of equipment; he should use a_____ A.sanitizer at a temp of 60F B.sanitizer that has more

During translation, the mrna is read in groups of three bases. true false

A right triangle height of 10cm and a hypotenuse of 26cm what is the b

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following statements is true regarding the Central Limit Theorem? The samples are dependent. The sample size is small. The sample mean is not no