jenniferrodrick jenniferrodrick
  • 03-03-2024
  • Biology
contestada

What 3 pieces of data would you expect to see for a developing country

Respuesta :

paizzthebest paizzthebest
  • 03-03-2024

Answer:

I would give Economy, Land and Prices

Answer Link

Otras preguntas

When did the eastern part of the Roman Empire fall?
Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i
CAN SOMEONE HELP ME WITH THIS PLEASE ??
What was the extent of islamic expansion one century after muhammad's death?
Can things of aluminum have a greater mass than things made of iron?
3m2+7=55 answer please
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The right to a trial by jury in a criminal case is outlined in which amendment?
who is the present president of liberia
A 12-foot ladder leans against the side of a house with its base 3 feet from the house. use the pythagorean theorem to approximate how high the ladder reaches u