elreemali03
elreemali03 elreemali03
  • 04-05-2017
  • History
contestada

can someone help me plz

can someone help me plz class=

Respuesta :

cassiegosa13
cassiegosa13 cassiegosa13
  • 04-05-2017
the answer is Susan B Anthony.
Answer Link
brantley999 brantley999
  • 04-05-2017
the answer is c i am a 100% sure i hope i helped
Answer Link

Otras preguntas

How would investment model researchers like rusbult and martz (1995) explain why battered women often return to their abusive partners?
can you guys help me with this simple math problem ?
Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip
Describe why plant cells are rigid:
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
Toco el piano _______________ hace dos meses. desde se les por
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
Which absorption rate of minerals is faster plant foods or animal foods?
The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat