AlexsanderK752865 AlexsanderK752865
  • 03-11-2022
  • Mathematics
contestada

Hello I need help with this please , I was studying it I don’t get this

Hello I need help with this please I was studying it I dont get this class=

Respuesta :

JazmynT16684 JazmynT16684
  • 03-11-2022

Given that

The Pythagoras theorem is true for all right triangles or not.

Explanation -

For each and every right-angled triangle the Pythagoras theorem can be used.

So the final answer is True.
Answer Link

Otras preguntas

how do you say theatre in Spanish
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
How to change 3 7/8 into an improper fraction
why did Mr Collins come to the Bennet family looking for a wife?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
A light bulb converts electrical energy into electromagnetic energy is true or false?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor