aryaahmadzai24
aryaahmadzai24 aryaahmadzai24
  • 03-10-2021
  • Health
contestada

If you were to eat 66 Doritos chips. How many calories did you have and if you can answer the second question pls do so

If you were to eat 66 Doritos chips How many calories did you have and if you can answer the second question pls do so class=

Respuesta :

thomvallen thomvallen
  • 03-10-2021

Explanation:

On the bag it says

12 chips per serving...150 calories per serving..

12×5=60 chips

150×5=750 calories

There are 210 MG of sodium per serving

210×5 servings=1050 grams of sodium

Answer Link
levilorang levilorang
  • 03-10-2021
825 calories and 1045 grams of sodium
Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.
find the prime factorization 504
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
solve the simultaneous equation 4x+7y=1 3x+10y=15
Why was wilson not able to finish his speaking tour
What property is shown by the equation? 1. 0 ÷ (–6) = 0
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5