sldkzkrand sldkzkrand
  • 01-10-2021
  • Mathematics
contestada

I think it’s 12/20 but I don’t know!?

I think its 1220 but I dont know class=

Respuesta :

caraw70
caraw70 caraw70
  • 01-10-2021

Answer:

Its 12/20.

Step-by-step explanation:

You are correct.  Use the KCF method and you get 12/20.  

Answer Link

Otras preguntas

Please someone help !!!!!! I will give brainliest !
okay do you enjoy Coraline, or are you scared of it? BTW this is chessy cat, personally I love Coralie ​
How many elements are in a 9 x 3 matrix?​
Balancing Equations. How many of the element should I drag to the center?
Please help. Im giving brainly. READ THE QUESTION.. Your not supposed to solve it just tell me what you do :)
What impact do those in a career in sports turf management have on the agriculture industry and overall economy?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What is the landing velocity of an object that is dropped from a height of 49 m?
4. is an iron-containing protein that binds chemically to oxygen molecules
Probing the Earth and other planets indirectly through the use of aerial photographs and satellite images is an example of __________.a.geologyb.cartographyc.re