kyla1syde kyla1syde
  • 02-06-2021
  • Mathematics
contestada

help me with number 3 please

help me with number 3 please class=

Respuesta :

marissat0119 marissat0119
  • 02-06-2021
The answer would be 22%
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
The Panama Canal connects what two bodies of water?
round 7,782 to the nearest hundred
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Compliant is to stubborn as excited is to
where are the three parts of an atom located