gamingkid gamingkid
  • 04-05-2021
  • Geography
contestada

-How/ Why did the Caste System began?

If your answer is in one paragraph, then I’ll give Brainliest!

Respuesta :

poppyslam
poppyslam poppyslam
  • 05-05-2021

Answer:

The social historical theory explains the creation of the Varnas, Jats and of the untouchables. According to this theory, the caste system began with the arrival of the Aryans in India. The Aryans arrived in India around 1500 BC. The fair skinned Aryans arrived in India from south Europe and north Asia.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What was George Washington's nickname?
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
What is the range of function of y-1=(x+3)^2
how can you write 0.45 as fraction and a percentage ,please show work
Give a recursive algorithm for finding the sum of the first n odd positive integers.