kaysee20091 kaysee20091

02-02-2021
Biology

contestada

What is the ONLY sex carriers of colorblindness can be?

Respuesta :

itsjustArat itsjustArat

02-02-2021

Their father is colorblind and mom is a carrier to make x’x’

Answer Link

Otras preguntas

At age 76 years, which chronic condition is elizabeth most likely to have?

What did president wilson's wife make sure was on the white house lawn?

Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!

PLEASE HELP ME !!!! Use I = PRT to solvEI = $350 P= $700 Find T (TIME IN YEARS) R= 10% (

the world-systems approach argues that peripheral nations exploit core nations in various ways True or False

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What are some examples of dramatic irony in The Hobbit?

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?

help pls :) I am stuck on this chemistry question about percentage yields!