Seudónimo Seudónimo
  • 02-03-2020
  • Mathematics
contestada

5a- 15
8ax - 56a don't know how to do it ​

Respuesta :

goddessboi goddessboi
  • 02-03-2020

Answer:

What do you need to do? It's unclear.

Step-by-step explanation:

Answer Link

Otras preguntas

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
How to change 3 7/8 into an improper fraction
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Round 46.895 to the nearest tenth
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Why were the committees of correspondence powerful?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
is a centimeter one tenth or one hundredth or a meter
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites