happ5757 happ5757
  • 03-12-2019
  • Mathematics
contestada

12k + 5k − 11m + 13m

Respuesta :

gia23760
gia23760 gia23760
  • 16-02-2021

Answer:

17k - 24m

Step-by-step explanation:

combine like terms

Answer Link

Otras preguntas

Determine the molecular weight of H2O. 189 18.0 g 18.019 18.016 9
p and q are two numbers such that p > q. When you subtract 15 from p and subtract 15 from q answers are in ratio 2 : 1. When you add 30 to p and add 30 to q
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
But it naturally raises the question of how, in Rogerian theory, one could explain the personality of people who seem oriented toward evil rather than positivel
I think the message behind the central idea is...​
if xh=10 feet and mxy =100 degrees then determine the arc length of xy
Nick wants to write thank-you notes to 15 of his friends. The cards are sold in packs of 6. How many does he need to buy?
i don't really understand this question ​
On January 1, Year 1, Friedman Company purchased a truck that cost $29,000. The truck had an expected useful life of 200,000 miles over 8 years and an $7,000 sa
What is 0.13% of 4400? Round to the nearest hundredth (if necessary).