kentrematt186 kentrematt186

01-11-2018
English

contestada

Name the plant cell organelle where photosynthesis occurs.

Respuesta :

lovetearia lovetearia

01-11-2018

THE ANSWER IS photosynthesis takes place in chloroplasts

Answer Link

emilychirinos73 emilychirinos73

02-11-2018

The answer is chloroplast

Answer Link

Otras preguntas

Why does Helen go to bed happy at the end of the chapter?

PLEASE HELP ME !!!! Use I = PRT to solvEI = $350 P= $700 Find T (TIME IN YEARS) R= 10% (

Can someone please help me with numbers 1, a, b, c, 2, a, b, c

What did Chinese traders exchange with Islamic merchants?

Find the area of a kite with diagonals 10 & 5

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

Social disparity was one of the major causes of french revolution. Justify the statement

Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these

The most famous trade route, the silk road, connected _____________ with _________ and ___________.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat